ID: 1165755260_1165755264

View in Genome Browser

Spacer: 7

Left Crispr Right Crispr
Crispr ID 1165755260 1165755264
Species Human (GRCh38) Human (GRCh38)
Location 19:38289140-38289162 19:38289170-38289192
Sequence CCCAGAAGGCAGGATTCTGAAGA AGCGATATGTTCAACTATGAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 41, 4: 299} {0: 1, 1: 0, 2: 1, 3: 0, 4: 106}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!