ID: 1165803508_1165803516

View in Genome Browser

Spacer: -6

Left Crispr Right Crispr
Crispr ID 1165803508 1165803516
Species Human (GRCh38) Human (GRCh38)
Location 19:38566887-38566909 19:38566904-38566926
Sequence CCCTGATGCTTGCCCTGTCCCTA TCCCTAGGTGGATGGAGTGGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 58, 4: 208} {0: 1, 1: 0, 2: 4, 3: 13, 4: 233}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!