ID: 1165831026_1165831030

View in Genome Browser

Spacer: -6

Left Crispr Right Crispr
Crispr ID 1165831026 1165831030
Species Human (GRCh38) Human (GRCh38)
Location 19:38730365-38730387 19:38730382-38730404
Sequence CCTCCAGAGGTGGAGGTGGGCTG GGGCTGATGGCCTGGCTGCCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 46, 4: 414} {0: 1, 1: 0, 2: 5, 3: 50, 4: 464}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!