ID: 1165886734_1165886745

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 1165886734 1165886745
Species Human (GRCh38) Human (GRCh38)
Location 19:39084218-39084240 19:39084239-39084261
Sequence CCGGCCGGACCTGTGGGACCCGG GGGGCCCTGGCTGTCTAGGGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 22, 4: 260} {0: 1, 1: 0, 2: 1, 3: 44, 4: 301}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!