ID: 1165902580_1165902584

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 1165902580 1165902584
Species Human (GRCh38) Human (GRCh38)
Location 19:39175577-39175599 19:39175593-39175615
Sequence CCTGGTGGAGCAGCCCAGAGTCA AGAGTCAGGTTCCAGCTCAGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 20, 4: 237} {0: 1, 1: 0, 2: 2, 3: 18, 4: 231}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!