ID: 1165902580_1165902590

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 1165902580 1165902590
Species Human (GRCh38) Human (GRCh38)
Location 19:39175577-39175599 19:39175613-39175635
Sequence CCTGGTGGAGCAGCCCAGAGTCA TGGGGACTCTGTGCAGTGGGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 20, 4: 237} {0: 1, 1: 1, 2: 4, 3: 51, 4: 395}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!