ID: 1165941345_1165941356

View in Genome Browser

Spacer: -6

Left Crispr Right Crispr
Crispr ID 1165941345 1165941356
Species Human (GRCh38) Human (GRCh38)
Location 19:39416247-39416269 19:39416264-39416286
Sequence CCCCCAGCCCCAGCAGACCATTG CCATTGGGGCCTCAGCCTCCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 41, 4: 465} {0: 1, 1: 0, 2: 3, 3: 135, 4: 2320}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!