ID: 1166014681_1166014690

View in Genome Browser

Spacer: 15

Left Crispr Right Crispr
Crispr ID 1166014681 1166014690
Species Human (GRCh38) Human (GRCh38)
Location 19:39971173-39971195 19:39971211-39971233
Sequence CCAGGCCACACAGAGGCCGGCTT GATAGGCATCTTGGTGGAGAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 168} {0: 1, 1: 1, 2: 2, 3: 20, 4: 213}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!