ID: 1166014681_1166014692

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 1166014681 1166014692
Species Human (GRCh38) Human (GRCh38)
Location 19:39971173-39971195 19:39971225-39971247
Sequence CCAGGCCACACAGAGGCCGGCTT TGGAGAAGGCTCAGGTACAGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 168} {0: 1, 1: 0, 2: 3, 3: 25, 4: 331}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!