ID: 1166046126_1166046142

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 1166046126 1166046142
Species Human (GRCh38) Human (GRCh38)
Location 19:40232188-40232210 19:40232236-40232258
Sequence CCCCAGCTGCCCTCACCCTGAGC CGGCTAGTACAGGAGGAGCTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 9, 3: 55, 4: 606} {0: 1, 1: 0, 2: 0, 3: 20, 4: 87}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!