ID: 1166052028_1166052031

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 1166052028 1166052031
Species Human (GRCh38) Human (GRCh38)
Location 19:40266083-40266105 19:40266104-40266126
Sequence CCTTCACTTCTGTCCTCAGGGAC ACCAGCAACCAACAGACTGAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 5, 3: 34, 4: 323} {0: 1, 1: 0, 2: 2, 3: 12, 4: 161}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!