ID: 1166060220_1166060233

View in Genome Browser

Spacer: 5

Left Crispr Right Crispr
Crispr ID 1166060220 1166060233
Species Human (GRCh38) Human (GRCh38)
Location 19:40321277-40321299 19:40321305-40321327
Sequence CCACCGCCGACGAGGGGGCCGCT GCCGGAGGTACAGGAGGGTCGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 62} {0: 1, 1: 0, 2: 0, 3: 10, 4: 230}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!