ID: 1166096255_1166096267

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 1166096255 1166096267
Species Human (GRCh38) Human (GRCh38)
Location 19:40541335-40541357 19:40541376-40541398
Sequence CCAGAGGCAGGCTCCAGCACGAG CAGCAGAGGGAGCCCGAGGCAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 4, 3: 158, 4: 1030}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!