ID: 1166102250_1166102257

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 1166102250 1166102257
Species Human (GRCh38) Human (GRCh38)
Location 19:40577574-40577596 19:40577601-40577623
Sequence CCCTACAGTCTTCGCCCCCATCC CTTCCTGCGCACCAAAGAGTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 131} {0: 1, 1: 0, 2: 0, 3: 12, 4: 84}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!