ID: 1166108852_1166108856

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 1166108852 1166108856
Species Human (GRCh38) Human (GRCh38)
Location 19:40610817-40610839 19:40610832-40610854
Sequence CCTGGGATGCAGAGGCCAAGTGA CCAAGTGATGGGAAACAGAAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 6, 3: 51, 4: 469} {0: 1, 1: 0, 2: 2, 3: 29, 4: 296}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!