ID: 1166109701_1166109709

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 1166109701 1166109709
Species Human (GRCh38) Human (GRCh38)
Location 19:40614452-40614474 19:40614467-40614489
Sequence CCTGCCCCCACCCGCCTTCGCTA CTTCGCTAGCGCTTGCAACGCGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 3, 3: 14, 4: 265} {0: 1, 1: 0, 2: 0, 3: 0, 4: 8}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!