ID: 1166147036_1166147046

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 1166147036 1166147046
Species Human (GRCh38) Human (GRCh38)
Location 19:40845014-40845036 19:40845051-40845073
Sequence CCCTATGACAAAAGGCCGAATGG TTTCTTAAGATAGGAAGTTTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 87} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!