ID: 1166154247_1166154252

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 1166154247 1166154252
Species Human (GRCh38) Human (GRCh38)
Location 19:40899005-40899027 19:40899041-40899063
Sequence CCATTTTAAAATGCCAAAAGCAT CTGTATGAACACAAGCAGCAGGG
Strand - +
Off-target summary {0: 2, 1: 1, 2: 7, 3: 85, 4: 839} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!