ID: 1166259298_1166259311

View in Genome Browser

Spacer: 15

Left Crispr Right Crispr
Crispr ID 1166259298 1166259311
Species Human (GRCh38) Human (GRCh38)
Location 19:41626863-41626885 19:41626901-41626923
Sequence CCCTCTTCCCACCACTCCCAGAG TGTGATCAGGAGCCCCTGCCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 60, 4: 602} {0: 1, 1: 3, 2: 14, 3: 19, 4: 188}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!