ID: 1166316873_1166316892

View in Genome Browser

Spacer: 27

Left Crispr Right Crispr
Crispr ID 1166316873 1166316892
Species Human (GRCh38) Human (GRCh38)
Location 19:41994247-41994269 19:41994297-41994319
Sequence CCGCCTCCTCATATGCCCGCGTC CAGGGGCGCCGCCGTGCTGACGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 13, 4: 122} {0: 1, 1: 0, 2: 0, 3: 6, 4: 102}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!