ID: 1166328431_1166328439

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 1166328431 1166328439
Species Human (GRCh38) Human (GRCh38)
Location 19:42065328-42065350 19:42065372-42065394
Sequence CCAAGGCCAAGGCCAGACGCTCA TCATCCAGGATTGCAGCTGAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 333} {0: 1, 1: 0, 2: 2, 3: 12, 4: 183}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!