ID: 1166331202_1166331212

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 1166331202 1166331212
Species Human (GRCh38) Human (GRCh38)
Location 19:42079038-42079060 19:42079073-42079095
Sequence CCGGCAGACGCACCTCCGGGCCA CTCCTGCCCCTGTTGTCCTGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 129} {0: 1, 1: 0, 2: 6, 3: 48, 4: 337}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!