ID: 1166364497_1166364516

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 1166364497 1166364516
Species Human (GRCh38) Human (GRCh38)
Location 19:42271813-42271835 19:42271865-42271887
Sequence CCTTTCAGGTCCTGGCAGTGGCA GCTCTGAGGCGGCGAGGGGCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 21, 4: 192} {0: 1, 1: 0, 2: 3, 3: 36, 4: 375}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!