ID: 1166364790_1166364803

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 1166364790 1166364803
Species Human (GRCh38) Human (GRCh38)
Location 19:42272908-42272930 19:42272960-42272982
Sequence CCCCAAACAGCCCGAGGATGCTG CTGGGTACTCACTGTGAGGAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 10, 4: 117} {0: 1, 1: 0, 2: 2, 3: 12, 4: 211}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!