ID: 1166384287_1166384298

View in Genome Browser

Spacer: 7

Left Crispr Right Crispr
Crispr ID 1166384287 1166384298
Species Human (GRCh38) Human (GRCh38)
Location 19:42371516-42371538 19:42371546-42371568
Sequence CCCTACACCTTGTGGAGGTCAGG TGAGGTAGCCAGGCTCGGGCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 107} {0: 1, 1: 0, 2: 1, 3: 17, 4: 220}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!