ID: 1166567171_1166567177

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 1166567171 1166567177
Species Human (GRCh38) Human (GRCh38)
Location 19:43772280-43772302 19:43772328-43772350
Sequence CCTGGACAAAAAGCCATTAAGTT CTCCTCTCTGCTGTGTGACCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 192} {0: 1, 1: 1, 2: 10, 3: 58, 4: 422}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!