ID: 1166570296_1166570307

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 1166570296 1166570307
Species Human (GRCh38) Human (GRCh38)
Location 19:43791632-43791654 19:43791680-43791702
Sequence CCCTGCAAGCTCTGCCTTCCAGG TCCCATGTAGCTGGGACTACAGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!