ID: 1166594005_1166594009

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 1166594005 1166594009
Species Human (GRCh38) Human (GRCh38)
Location 19:44028252-44028274 19:44028268-44028290
Sequence CCTCCCACTTTCTGCTTAGCTGG TAGCTGGCTAGTGACCTCAATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 24, 4: 235} {0: 1, 1: 0, 2: 0, 3: 1, 4: 72}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!