ID: 1166669486_1166669489

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 1166669486 1166669489
Species Human (GRCh38) Human (GRCh38)
Location 19:44701357-44701379 19:44701376-44701398
Sequence CCAGGTCCTGCGGCAGACGGAGC GAGCCGAGCCCCAACCAGGAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 152} {0: 1, 1: 0, 2: 1, 3: 11, 4: 129}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!