ID: 1166679859_1166679880

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 1166679859 1166679880
Species Human (GRCh38) Human (GRCh38)
Location 19:44759548-44759570 19:44759596-44759618
Sequence CCTTTGCTGGGGTCCTCCGAGGC CAGCTCCAGGAGGCAGCTGAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 160} {0: 1, 1: 1, 2: 7, 3: 59, 4: 438}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!