ID: 1166682502_1166682511

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 1166682502 1166682511
Species Human (GRCh38) Human (GRCh38)
Location 19:44777739-44777761 19:44777766-44777788
Sequence CCACCGCTCCCGGCCTCCAAATC CTCTTGAAGACCCACGTGCCAGG
Strand - +
Off-target summary {0: 1, 1: 4, 2: 35, 3: 427, 4: 2829} {0: 1, 1: 0, 2: 0, 3: 10, 4: 85}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!