ID: 1166720343_1166720354

View in Genome Browser

Spacer: 5

Left Crispr Right Crispr
Crispr ID 1166720343 1166720354
Species Human (GRCh38) Human (GRCh38)
Location 19:44992746-44992768 19:44992774-44992796
Sequence CCCTCACGCCCACACCTGCACCC GACCACCGCCACCAGGGAGGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 55, 4: 608} {0: 1, 1: 0, 2: 0, 3: 23, 4: 191}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!