ID: 1166768222_1166768234

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 1166768222 1166768234
Species Human (GRCh38) Human (GRCh38)
Location 19:45265086-45265108 19:45265130-45265152
Sequence CCGGATGTAGGTTTGCAGGTGCC GTTTGGGCATGAAGGCGCCCCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 6, 4: 94} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!