ID: 1166782835_1166782847

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 1166782835 1166782847
Species Human (GRCh38) Human (GRCh38)
Location 19:45351321-45351343 19:45351370-45351392
Sequence CCTCAGCGCCAGCACCCAGGACC TGCGCTGGCCGCAGCTTCTTGGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 6, 3: 51, 4: 444} {0: 1, 1: 0, 2: 0, 3: 7, 4: 85}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!