ID: 1166788927_1166788942

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 1166788927 1166788942
Species Human (GRCh38) Human (GRCh38)
Location 19:45386048-45386070 19:45386096-45386118
Sequence CCTCCTTCACCGCCTGCTGCACC CGTCCAGGAGGAGCACCAGAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 75, 4: 521} {0: 1, 1: 0, 2: 1, 3: 12, 4: 148}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!