ID: 1166794627_1166794638

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 1166794627 1166794638
Species Human (GRCh38) Human (GRCh38)
Location 19:45419158-45419180 19:45419189-45419211
Sequence CCCATGGATGTAGTCTGGGTGCA TAGCGGAGGCTGGTGGGGGCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 81} {0: 1, 1: 0, 2: 5, 3: 47, 4: 522}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!