ID: 1166856714_1166856722

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 1166856714 1166856722
Species Human (GRCh38) Human (GRCh38)
Location 19:45785971-45785993 19:45785986-45786008
Sequence CCGGGCCGCCCGCCTTGCCCCCG TGCCCCCGCCAGCTGGGTGCGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 42, 4: 628} {0: 1, 1: 0, 2: 3, 3: 9, 4: 188}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!