ID: 1166863762_1166863770

View in Genome Browser

Spacer: 5

Left Crispr Right Crispr
Crispr ID 1166863762 1166863770
Species Human (GRCh38) Human (GRCh38)
Location 19:45824054-45824076 19:45824082-45824104
Sequence CCCTGCAGCTCCTCCAGACATGG CTCCAGCTCCCAGCCCTGGCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 26, 4: 293} {0: 1, 1: 2, 2: 12, 3: 71, 4: 556}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!