ID: 1166867431_1166867435

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 1166867431 1166867435
Species Human (GRCh38) Human (GRCh38)
Location 19:45848491-45848513 19:45848527-45848549
Sequence CCAGGGCTAAGCACAGAGGACAT CTGTTGAGTGAATAAACGGATGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!