ID: 1166874977_1166874993

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 1166874977 1166874993
Species Human (GRCh38) Human (GRCh38)
Location 19:45891421-45891443 19:45891474-45891496
Sequence CCAGAACTATCCTTCTCACCCCC TCACCCAGGCTGTAGTGCAGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 20, 4: 244} {0: 984, 1: 88556, 2: 177808, 3: 206875, 4: 177759}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!