ID: 1166959659_1166959669

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 1166959659 1166959669
Species Human (GRCh38) Human (GRCh38)
Location 19:46489871-46489893 19:46489922-46489944
Sequence CCGCGTGGTTCATTCCGACCGTC GCGTGCCAGGCACGGTGTTGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 20} {0: 1, 1: 0, 2: 2, 3: 32, 4: 245}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!