ID: 1166974756_1166974759

View in Genome Browser

Spacer: 11

Left Crispr Right Crispr
Crispr ID 1166974756 1166974759
Species Human (GRCh38) Human (GRCh38)
Location 19:46599418-46599440 19:46599452-46599474
Sequence CCACTTTGTCTGTGGCTATTCTC CTCCCTTGAGGCACTCCTGATGG
Strand - +
Off-target summary {0: 1, 1: 2, 2: 7, 3: 43, 4: 317} {0: 1, 1: 0, 2: 0, 3: 10, 4: 102}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!