ID: 1166997740_1166997754

View in Genome Browser

Spacer: 15

Left Crispr Right Crispr
Crispr ID 1166997740 1166997754
Species Human (GRCh38) Human (GRCh38)
Location 19:46727886-46727908 19:46727924-46727946
Sequence CCTCTTACCTTCATGTGGCCGGG GAGGCGGGCCAGTCACTTTTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 59} {0: 1, 1: 0, 2: 1, 3: 6, 4: 78}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!