ID: 1166998842_1166998857

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 1166998842 1166998857
Species Human (GRCh38) Human (GRCh38)
Location 19:46733052-46733074 19:46733098-46733120
Sequence CCTCGATCTGTTTCACCAGCAGC AGGGCCTGGTGGAGCCCTGGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 145} {0: 1, 1: 0, 2: 6, 3: 66, 4: 456}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!