ID: 1167090739_1167090743

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 1167090739 1167090743
Species Human (GRCh38) Human (GRCh38)
Location 19:47341914-47341936 19:47341949-47341971
Sequence CCTTCCTTCATTCAACAGATATC GCTATGTGCAAGGCCTTTTTAGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 13, 3: 108, 4: 540} {0: 1, 1: 0, 2: 1, 3: 13, 4: 163}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!