ID: 1167215552_1167215555

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 1167215552 1167215555
Species Human (GRCh38) Human (GRCh38)
Location 19:48162093-48162115 19:48162109-48162131
Sequence CCTGGATCCAGCTGTGCCTGCAG CCTGCAGCTGCTCTTGCTCTTGG
Strand - +
Off-target summary {0: 3, 1: 25, 2: 108, 3: 288, 4: 821} {0: 1, 1: 0, 2: 5, 3: 53, 4: 449}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!