ID: 1167238061_1167238067

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 1167238061 1167238067
Species Human (GRCh38) Human (GRCh38)
Location 19:48326820-48326842 19:48326841-48326863
Sequence CCCTCCCCAGGCTTCCACTGCAG AGCCATGTCACTCCTCTTGCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 5, 3: 47, 4: 484} {0: 1, 1: 0, 2: 0, 3: 11, 4: 141}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!