ID: 1167286999_1167287010

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 1167286999 1167287010
Species Human (GRCh38) Human (GRCh38)
Location 19:48603879-48603901 19:48603910-48603932
Sequence CCTCGGTGCAGGCGTGCGTCACT AGCTGGGGGTCGGGGAGTAGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 57} {0: 1, 1: 0, 2: 8, 3: 64, 4: 697}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!