ID: 1167288207_1167288222

View in Genome Browser

Spacer: 24

Left Crispr Right Crispr
Crispr ID 1167288207 1167288222
Species Human (GRCh38) Human (GRCh38)
Location 19:48610689-48610711 19:48610736-48610758
Sequence CCAGGGGTTCACCCCCAGCTGCT GCTGCTGGCGGTCCAGGAGCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 26, 4: 221} {0: 1, 1: 0, 2: 4, 3: 41, 4: 367}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!