ID: 1167305268_1167305271

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 1167305268 1167305271
Species Human (GRCh38) Human (GRCh38)
Location 19:48704643-48704665 19:48704679-48704701
Sequence CCATCACATGCAGATAATTCCTT AAAGAGGCTCGTTCTTGTCTTGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 1, 3: 28, 4: 472} {0: 2, 1: 0, 2: 0, 3: 7, 4: 101}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!